Review




Structured Review

Lucigen Corp maxima h reverse transcriptase mixture
Maxima H Reverse Transcriptase Mixture, supplied by Lucigen Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/maxima h reverse transcriptase mixture/product/Lucigen Corp
Average 86 stars, based on 1 article reviews
maxima h reverse transcriptase mixture - by Bioz Stars, 2026-06
86/100 stars

Images



Similar Products

99
New England Biolabs m0536 maxima h minus reverse transcriptase thermofisher
M0536 Maxima H Minus Reverse Transcriptase Thermofisher, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m0536 maxima h minus reverse transcriptase thermofisher/product/New England Biolabs
Average 99 stars, based on 1 article reviews
m0536 maxima h minus reverse transcriptase thermofisher - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

94
TaKaRa assays maxima h minus reverse transcriptase thermofisher cat
KEY RESOURCES TABLE
Assays Maxima H Minus Reverse Transcriptase Thermofisher Cat, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/assays maxima h minus reverse transcriptase thermofisher cat/product/TaKaRa
Average 94 stars, based on 1 article reviews
assays maxima h minus reverse transcriptase thermofisher cat - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

86
Lucigen Corp maxima h reverse transcriptase mixture
KEY RESOURCES TABLE
Maxima H Reverse Transcriptase Mixture, supplied by Lucigen Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/maxima h reverse transcriptase mixture/product/Lucigen Corp
Average 86 stars, based on 1 article reviews
maxima h reverse transcriptase mixture - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Molecular cell

Article Title: Dissecting cell-type composition and activity-dependent transcriptional state in mammalian brains by massively parallel single-nucleus RNA-Seq

doi: 10.1016/j.molcel.2017.11.017

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Dulbecco’s Modified Eagle’s Medium Life Technologies Cat#11965084 Fetal Bovine Serum Life Technologies Cat#26140079 L-glutamine Life Technologies Cat#25030081 0.05% Trypsin Life Technologies Cat#25300054 Matrigel matrix Corning Cat#354230 DMEM/F12 Life Technologies Cat#11320033 TeSR-E8 Medium Stem Cell Technologies Cat#05940 DPBS, no calcium, no magnesium Invitrogen Cat#14190136 Sucrose Sigma-Aldrich Cat#S0389-1KG 1M Tris-HCl, pH 8.0 Invitrogen Cat#15568-025 MgAc 2 Sigma-Aldrich Cat#M5661-50G cOmplete ™ , EDTA-free Protease Inhibitor Cocktail Roche Cat#11873580001 CaCl 2 Sigma-Aldrich Cat#C1016-500G Triton X-100 Sigma-Aldrich Cat#T8787-100mL 0.5M EDTA, pH 8.0 Invitrogen Cat#15575-020 NxGen RNase Inhibitor Lucigen Cat#30281-2 Bovine Serum Albumin Sigma-Aldrich Cat#A8806-5G Ficoll PM-400 GE Healthcare/Fisher Scientific Cat#45-001-745 Sarkosyl Sigma-Aldrich Cat#L7414-50mL DTT Fermentas Cat#R0862 QX200 Droplet Generation Oil for EvaGreen Bio-Rad Cat#186-4006 Perfluoro-1-octanol Sigma-Aldrich Cat#370533-25G dNTPs Clontech Cat#639125 Critical Commercial Assays Maxima H Minus Reverse Transcriptase ThermoFisher Cat#EP0753 KAPA HiFi hotstart readymix KAPA Biosystems Cat#KK2602 Deposited Data Raw and analyzed data This paper GEO: {"type":"entrez-geo","attrs":{"text":"GSE106678","term_id":"106678"}} GSE106678 Experimental Models: Cell Lines NIH3T3 ATCC Cat#CRL-1658 H7 (female, human embryonic stem cells) WiCell Cat#WA07 Experimental Models: Organisms/Strains Mouse: C57BL/6 From Dr. Joe Zhou N/A Oligonucleotides Template Switch Oligo: TSO: AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG Macosko et al., 2015 N/A TSO-PCR primer: AAGCAGTGGTATCAACGCAGAGT Macosko et al., 2015 N/A Illumina Nextera XT i7 primers: AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C Macosko et al., 2015 N/A Cuatom Read 1 Primer: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC Macosko et al., 2015 N/A Software and Algorithms Drop-seq_tools (v1.12) Macosko et al., 2015 http://mccarrolllab.com/dropseq/ STAR v2.5.2a Dobin et al., 2013 https://github.com/alexdobin/STAR Seurat v1.4 Satija et al., 2015 http://satijalab.org/seurat/ Seurat v2.0 Butler and Satija, 2017 http://satijalab.org/seurat/ GSEA Subramanian et al., 2005 http://software.broadinstitute.org/gsea/index.jsp DBSCAN Ester et al., 1996 https://cran.r-project.org/web/packages/dbscan/index.html MISO Katz et al., 2010 https://miso.readthedocs.io/en/fastmiso/ Random Forest Liaw and Wiener, 2002 https://www.stat.berkeley.edu/~breiman/RandomForests/ ggplot2 Wickham, 2016 https://cran.r-project.org/web/packages/ggplot2/ Other Detailed Bench Protocol This paper Methods S1 Tube, Thinwall, Polypropylene, 38.5 mL, 25 × 89 mm (qty.

Techniques: Recombinant, Modification, Protease Inhibitor, Software, Sterility